EST 504893 is a singleton


Sequence

>504893 (1 EST) Length=388 GGAATGCAAAAAGTTTTTTCTGATGAGAATGTTCAATATATTAAAGAAGCTTCTCTTGAATTTAAAAACAATTTGTTGGA ATATATGAAAGGTGTTATGCCATCTGAAAATGATTTTTCTAATGTTAGAAAAGAATTTCAAAAAGTATGTGTAAAATATT TTTCAGAGTTAAGAAGAAAATTTTTCCAGATATATAGAGACCCCAATAATAAGAATCAAAACGAAGATAATGTTGATAAT CATATGAATATTGAAGAAATAAGCCAAGAATTCTTCTCTGGTTTTAATCCTTTTGGAACTATGAAAATAAGAAAAGAACA AAATCCAGATTTATCACAAAAGGATAGTTTGATATTAAATGAAAATAATAATGATTCTCTTACATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 504893: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048931675077N980432105C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:10:54 on Fri 24 Nov 117.