EST 504903 is a singleton


Sequence

>504903 (1 EST) Length=236 CTTCTTTCATTTTTACCTTTTTGTAAATAATTAATTTATTATTTTATCAACATATATGTATATATATATATACATATATA TATATGTATATATTTTTTTTTTTTTTTTAAACCTTTTAAATTTATACTTGTGCAATTTGCTAATAACATTAAGATTTATT GCACATAATATATTTAAAAAATAAAAAATATTTTTACTAAGTGTCTACATTGGNAGCAAAAATAAGTTTGNNTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504903: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049031675087N980532117C3czapPFDd2.1, Debopam Chakrabarti


Date: 20:36:10 on Tue 21 Nov 117.