EST 504904 is a singleton


Sequence

>504904 (1 EST) Length=434 AATATTAAAATTGAAATATGTGATTTAGGTTCAGCAAAAAAAGTTCAAAGAAATATTATTTCTATTCCTTATATTTGCTC ACGTTGGTATAGAGCACCAGAATTATTATGTGGATCAATGTTTTATACGACGGAGGTTGATTTGTGGTCCCTCGGATGTA TTATTTTTGAGTTAATAAACCTGTGTCCGTTATTCCCTGGGAAGTTTAAGAAGGACGAATATTCAGAAGAATGTTCTCAA ATTATAAATTTAATTGAAGTCATAGGTTCTCCACAAATGAGTTTTTTTGAAAATATTAAAGACCACACCAGTAAAAAAAA TACATTACTTATAAAGGAATTATGTGAATTGAACATAAAACCCTTATGCTGGGATGAAATTCTTGGAAACATATTAGAAA TAGAGGAAAAGGAATTAATTAATATAATAGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504904: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049041675088N980542118C3czapPFDd2.1, Debopam Chakrabarti


Date: 21:6:46 on Fri 24 Nov 117.