EST 504906 is a singleton


Sequence

>504906 (1 EST) Length=333 TAAATGAAAAATAAAAAGAAAAGTAATTCAACAAATTTTTATTATATAAGGGGAATAACATTAAAAAAAATTAAAAACAT ATAGATAATTATATATATATAATCTCCTTATATTTTATTTTATTTTTTTGTGGACCAATAATACGATGTAGTTACATTAA CCTTTTTTTTTTTTTTAATAATTCAAAAGTTTTTAAATATATATTTATTTAATATTATTTTATTTTTTTTTTTTTTTTAA TATTTTTTATTTGTTTTTGNACCTTCATTTTGAATAACCTTATTAAAAACAAAGCTAAAATATATAATATTAACATAATA TATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 504906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049061675090N978322120C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:15:29 on Mon 20 Nov 117.