EST 504910 is a singleton


Sequence

>504910 (1 EST) Length=301 GGATAAAAAAGGAATTAATAATAAGTATTTTCANAATATTTATGGAATACATTTTATAAATAAATATAATATATATAATA TATATATAATATTTATATTTTATATATGNATGACGAAAATACGTTTTATATTTTTAATATATATTTATGTATTGTATATT ATAGCAAAGAAAAAAAAAATTTTTATTTTTTTTTATTATACCACATAGAATAATATTTTGATATGTATATTTTTTTTATA TATCATCTTATAAGAAATATAATATTTTTACATTTTTTTATAAAATTTTAAGTTGGAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504910: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049101675094N978362124C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:31:1 on Sun 19 Nov 117.