EST 504913 is a singleton


Sequence

>504913 (1 EST) Length=247 TAAATATTATATATTATTTTTATTTTTTTCTTCTATTTTCTGTTTTCAATTTTTCACACCCTTTTTTAGTTATAACATTT AAAATTTGTCATTCCCCCCCTTTTTTTTTTTCTTTTTTTGAATATTCTTAATTTATAATAATATATATATATATATATAT ATATATATTNATTTATTTTNCTTTAAACTCTTCAAAATAATTAAAAAAAAAATTTGAAAAATATTAAAAATATATAATTT TGTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504913: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049131675097N978392131C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:49:53 on Mon 20 Nov 117.