EST 504917 is a singleton


Sequence

>504917 (1 EST) Length=73 AACTAATATTATTTGATGAAGATTTTTAAAATATATTATTATCTTATCAATTAAAAGAATAAACTCATTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504917: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049171675101N978432135C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:31:4 on Fri 24 Nov 117.