EST 504918 is a singleton


Sequence

>504918 (1 EST) Length=280 GCCAGGACCACGGGCACACCACATAAATATATAAATAAATAAAAAAAAAAAAAAAAATATATATATATATATAATAATAT ATATATAATATATATATAATATATATATTNNCANGTGTGATATATGGCATTAAGCATATATATATAATATATAATATATT ATATATAATATATATTATATATNATATATATATAATATATTTATTTATCTATTTATTTATTTATTTAAACATTATATAAA TGTTTAAAAATAAAAAATTCCACTAANGTTTTATTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 504918: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049181675102N978442136C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:42:57 on Fri 17 Nov 117.