EST 504920 is a singleton


Sequence

>504920 (1 EST) Length=337 TAATTCTAATTATAAAAGAATAAAAATATAAGAGTATAACATTTGTAAAATGTTGACCAAGTTTTATTATTGTAAAATGC GCAAAGGAAAATCGCCTTCGAGCTTCTTTTCCCTACACAAGAAGTACCTCTTGACAGGCGTAACGATATTATCATTTATT TTTATGTTTCAGTATAAATATCACGAAGTATTAACAGTATATGAAGATAAGACGAATGTTCAGCAGAGTAGTCGTTTGTT TTGGACGCGTTTATTATTTGGGAGAACACGTAGTAGGATAACGGGGAGAATTTTTAATATTGAGATACCTCACTCTTATA GATTATATGTATATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504920: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049201675104N978462138C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:28:43 on Fri 17 Nov 117.