EST 504922 is a singleton


Sequence

>504922 (1 EST) Length=102 TATTTTTCCATGTATGTGTTCTCTTATTAAAAATGAAAATATTTATATATATTTAAATTGTGTGCAAACTATTGTTTAGC ACATGATTATATTTGTGACTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504922: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049221675106N980562141C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:16:3 on Fri 24 Nov 117.