EST 504926 is a singleton


Sequence

>504926 (1 EST) Length=435 GGAACATTATAATTAAAAACGACGAAATTAATAACTTCTTAAAAGTTAAAGAAAAAAAAATAAAAACAAAGATATAATAT ATATATATATATATATATGTATATATATATATATATGTGTGTATATATATTCATATGTTATAATGATTTTCCTTATTTTT TATTACTGAAGACTAAAAATACAAGGTGTAGATTTAAGGGTTAAGCCAAACATACATAAAAATACCTCTAAACAAATTAA AAATAAATTGACAAGTCTTTTGAAAAATAAAGATAAAGATTGTACAGGATTATATTTATCTTACCATATGGACACTTCTT GCCAAAACAATAAGATATATACAAAAGACATTTTATGTTGCTGCTGTGAGAAATACAAAAACGAGGATGGTAGCATATGC TCTTACAACAATTATAATAACATGAAAACTTATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504926: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049261675110N980602145C3czapPFDd2.1, Debopam Chakrabarti


Date: 18:32:47 on Sat 18 Nov 117.