EST 504928 is a singleton


Sequence

>504928 (1 EST) Length=379 TTTAATGAATAGGAAAAAAAATTAAAGATATATATATATAAAATAAATATATGTTATTTTAATTTTTAATATATAGTATT TAAAGAAATTTTGTATATATTTATATATTAAAATTGTATTTGNCGCCCCACATATATTATATATATTTAAACTGGGTTTA TTTAATTTATATAATAAAGAAAAAAAAAAATGAGNTTTGAAATTACGGAAGAGTATTATGTTCCCCCTGAGGTTTTATTT AACGCTTTTACCGATGCTTATACATTAACACGACTATCCAGGGGATCTTTAGCTGAAGTGGATTTAAAAGTTGGNGGAAA GTTCAGCCTTTTTTCTGGGAGCATATTAGGAGAATTTACAGAAATAACAAAGCCACACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504928: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049281675112N980622147C3czapPFDd2.1, Debopam Chakrabarti


Date: 18:2:14 on Tue 21 Nov 117.