EST 504929 is a singleton


Sequence

>504929 (1 EST) Length=169 GTACCTCCTTTTTAAAAATTTTTGTTTTTTTTATATTTTAAATTTTAAAGTTTTATTTCTTTTATATTTTATTTTATTTA ATTTCATTTTATTCCATTTCATTTTTTTAGTTTGTTTAAACAAAAAATTTTGACGAGTTTGATAATATTTTTTAAATAAA CTTTTCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504929: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049291675113N980632149C3czapPFDd2.1, Debopam Chakrabarti


Date: 1:11:3 on Mon 20 Nov 117.