EST 504936 is a singleton


Sequence

>504936 (1 EST) Length=399 AAAAAATCCAACATTACTTACGATGATAGCAGCAGTAATAATGTGTCTCAAGTAGTATCAAAAATTGATGAGGAAATAGA AAAAAGAACAACTAACGAAATATTACTTCTATGTAGAGCATGGGAAAATTATGTACATCCAAGAGCAAAAGAATATTGGA AAGATTCCCAACAACTTCAAAATATATTATGTAAAATTGCTAATGGTATAACAAAAAATNACGACCCANTTTTGGGTGAT GATTATGCGTGTGTNTTTTGGTATGGAGATAAAAATAAAAATGATAACTGTCCTATAATATCAGTAAAAAAAGGAAATGA TAATATAGAGACTATAACATATGTAAACAGAGNTCTTATATTCTTATATGCAGACGAAGCAAGTTTTCAAGAATTACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504936: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049361675120N980702158C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:4:38 on Sat 18 Nov 117.