EST 504939 is a singleton


Sequence

>504939 (1 EST) Length=413 TTATTTATTAATAAACACTTCACATGCATATGTTTATATAACACATTTTTTATATTATAAAGAGATAAGATATAGGAATG TGGAAGTTTATTACCATAATAATATTTTCCATATATTATATTGACGGAAAAAGTATATTGGGGAATAACAAANGTCATAA CAATTTGCCTATATCAAAAACGAATGAAGAAGAGGAAGGTAAAATAAATATAAATAATTTAATGCCTATAAAACAACATG ATAATATTATAGAAGATGTACATATTAAGGAGAACAAATTTATTTCCATAAAAAATAAAGACAAAAATGGTTCCTTTATT GATTTAAGTATGAGATATAATGAAAAAGAATCTGATAATGATGAGGAAGAAGAAGAAGATGAAGAAGACAGTGAAGATAA TAACACAAATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504939: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049391675123N980732163C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:50:19 on Sat 25 Nov 117.