EST 504940 is a singleton


Sequence

>504940 (1 EST) Length=306 ATATTATTATTATTACATATATATTATATATTTCTTCTTTTTTATAACTTTATATAAAAATAAATGAAGAAATTAAAAAA AAAAAATAAATAAAACAAAATTATATATATATATAGATGCTTTATTTATTTTTATATAATATACTATAAAAATATATTTT TAAAAAATAAAAGAATTATTATATCTTTATATATTATATATATAAAATATATATATATATATATAATATATATGAACAGG GGTATTATNCATNTAAAAAAAGAAAAAAAAAGGAATATACGAAAGAAAATAGAAATGAAAAAAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504940: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049401675124N980742229C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:24:51 on Thu 23 Nov 117.