EST 504941 is a singleton


Sequence

>504941 (1 EST) Length=380 GTTAATGGTTACATGTTTTAGTAAAAGTTATCAAAAAAAAAAATATATATAAAATATAATATATAGTATATATATTATCA CAGATTAATTAAATTATAAAACTATTAATAAAGGTGCCTTTCTTAAAGCATCCTTTTATATATATCTNCAAATATTTATA TGCTACATATCTCTATAAATACATAACAGGNGACATATATGAAGCACATAATTGTAACAATATATCATTATGTATATATT TATTTTATCCTTATTAAATAAATACTTTACGTAAGTAGTTTAACATATATATATATATATATATGACACATATTAAATAA AAAAAAATAACTTCATTAAACATTCAACATTTGCCACTAAATGTAATTACGAATGAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504941: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049411675125N980752230C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:23:19 on Mon 20 Nov 117.