EST 504945 is a singleton


Sequence

>504945 (1 EST) Length=300 CTCGTGCCGAATTCGGCACGAGGTTATATTCGGATGCTATAAAAGCAATGCAATATCCAGATGAAAATGAAAAAAAAGAA AATGAGGAAGCAAAAGAGAGAAAAATGAGACAACAAGAGGAATTAGCTCAAGCCGAGGAAGGAGATCTGGGCGATGATAA TGATTTGTTATAAGAAAGGATATAAGCGTAGCTATATCATAAAAAATGGAGTTTTTATAATCAATTCGAATAAATAAAAA AATATATATAATATGCACATATACACATATATATATATAAATATATATGTATATATATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504945: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049451675129N980792234C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:24:4 on Fri 24 Nov 117.