EST 504950 is a singleton


Sequence

>504950 (1 EST) Length=335 GTCTCGAGTTTTTTTTTTTTTTTTTTTTAGATTAATATTATTTTTAAAATGCTTCTTTTTGTATGTGTATACATTTTATA TATATCTATATATATATACATATCTACATGAACATTTTAAACCATTTAAAAATAATAATTAAATTAATTTTATTTTTCTT TTAAAATATATATCATTTATTTCAAAGGAAAGAAAAAATGTATAAATTAGTAAAAGTTGTAATTTTATAGATTAAATGTA TCAAGNGGGAGGCACATGTTTAATATATCTAATACAATATAAAGGTGTACATATATATATATATATATATATATATATAT ATATGTATGTATGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 504950: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049501675134N980842243C3czapPFDd2.1, Debopam Chakrabarti


Date: 9:15:9 on Sat 18 Nov 117.