EST 504951 is a singleton


Sequence

>504951 (1 EST) Length=267 TCCGGCGGGTATAGGTTTTATTGATGGCCTCATCCACACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATC TGCCGGTCAATCAGCCAGCTTTCCTCACCCGGTCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGGGCCCGGT ACCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCG TTACCCAACTTAATCGCCTTGCAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504951: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049511675135N980852245C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:11:25 on Sun 19 Nov 117.