EST 504952 is a singleton


Sequence

>504952 (1 EST) Length=128 GGCGTGCATTTTGAAATATAGTTATCCAAGGGACGACCAAAAATGGAGAGCTAAATCGGGAGTTATTATTGCCAACTTTA GTGACGACAAAAATGATAAAGTAAACAGAGACGAACTTTAATAATAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504952: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049521675136N980862250C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:31:19 on Sat 25 Nov 117.