EST 504956 is a singleton


Sequence

>504956 (1 EST) Length=350 TCGAGTTTTTTTTTTTTTTTTTTCTNAAAGTCAATATTCGAAACTCCTTTATTTTCTTGCTTNNCCACAAGTTGATTTAA TTTATTTATCAAATCATCAGCAATATTATTTTGTCCTNCATCACTTCCTTTCACATCCCCATACTTTGATGCTTCATCTT CTGAAGCACTATCCATTAAAATAAAATTGNNGGGGGTATTAGGCTCTAATATTTCCATCCTTGAACCTCTTTCTTTATCT TGTTCATTTATTGTTACTCCATCCCATGATATTGTTTTTTTTGTAACGGATTTATCAACTTTTTTTTTCATTATTTGTCT TATTAAATCATATTTTCCTTAATATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049561675140N980902168C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:17:15 on Thu 23 Nov 117.