EST 504957 is a singleton


Sequence

>504957 (1 EST) Length=296 CTTTTTTTTTTTGTTGTTGTTTTGTTTGTATCATCTTTAATAAGTGAAAATAATTCCTCCTTCTTATCCTTCGTGTTCTT TTTTTTTTGTTTTGTTTGTATCATCTTTAATAAGTGAAAATAATTCCTCCTTCTTATCCTTCGTGTTCTTTTTTTTTTGT TTTGTTTGTATCATCTTTAATAAGTGAAAATAATTCCTTCTTCTTATCCTTCGTGTTCTTTTTTTTTTTGTTTTGTTTGT ATCATCTTTAATAAGTGAAAATAATTCCTTCTTCTTATCCTTCGTGTTCTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049571675141N980912169C3czapPFDd2.1, Debopam Chakrabarti


Date: 9:34:22 on Sun 19 Nov 117.