EST 504963 is a singleton


Sequence

>504963 (1 EST) Length=300 AAAAAGAAAAAGCATATTTTTAATTTTAATAATAGAAAATAATTTTTTTTTTTTTTTTTTTTATTATTTAAATATTTATA TTATATATATATATATATATATATATGTGTAAATTTTTTTTTTATTTATATATATCATNCACGAAAAGACTCAAGAAAGA AAAACTTTTATATATTATTTATATTTAAATAAGAATTCGTTTTAATTAAAAAAAAAAAAAAAAAAAAAAAAAAACCTCGG GGGGGGGCCCGGAACCCAATTCGCCCTATAGGGAGTCGTATTACAATNCACTGGCCGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504963: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049631675147N980972175C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:56:34 on Tue 21 Nov 117.