EST 504969 is a singleton


Sequence

>504969 (1 EST) Length=282 CGTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACTGAGTTTTTTT TTTTTTTTTTTTNGAATTTTACATGAAATATCATACTTCACAAAAAATACGAGCTAAAATGAATTTACATTTTTTTTATT TTTNCTTATAATTTATTTTATATATTTATAAAAAATCCTAATACGTTTTTTTTTTTTTTTTTTTTTTTNACCTATAAATT ATATATTATATTATAAAATTATATATTGGGATTTTATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504969: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049691675153N981032182C3czapPFDd2.1, Debopam Chakrabarti


Date: 5:52:21 on Sun 19 Nov 117.