EST 504970 is a singleton


Sequence

>504970 (1 EST) Length=282 TTAATTCTGTGTCCTGGGTCTTTTATCATTTATATATAAAAAAAAAAAAAAAAATATATTTATATTTGTTCCCTGCCTAA TATCAAATAATTACGAGAACATTATAATAAGCCTCAAAATGTAAAGAAAAAAAAAACATTGTNAACATTTTTATTGAATT ATACAAAAGAAGGGAGTATCATATATATATATATATTTATATATATACTNATCCANTAATTATTAAAAAAAAAAATTAAN ATTNACAGAATAACATATATGTAANTATATTNGACACGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504970: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049701675154N981042183C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:25:45 on Tue 21 Nov 117.