EST 504971 is a singleton


Sequence

>504971 (1 EST) Length=361 TAATTTGNTCATTTTTATATTACTATATAAAATTTTTCTTATTTTTCATCTTCAAATTATTTAAATTTTATTTATTAAAA TTTAAAAAAAGAAAAAAAAAAAAAGTAAAATGAAAAAGTTATAAACAATAATATAAACTCTTTTTTTTTTTTTTTTAATC TTTTTTATATTCATAAATATAACTAAGAAATATAAAACTTTAAAAAGTAAAATAAGCAAAATGGTGTAACCTTTTTACTT TTAGGGAACTAAAGAAAAATAAAACATTCTTGGGGAAAAAAAAAAAAAAAAATATTATATATATATATAGATTAATAATA TATAGACATGATTCTTTTTGNAAGAATTAGTTATGTGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504971: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049711675155N981052184C3czapPFDd2.1, Debopam Chakrabarti


Date: 9:31:9 on Thu 23 Nov 117.