EST 504983 is a singleton


Sequence

>504983 (1 EST) Length=228 AAATAATTAAATGTATATAGAATGTAATATATAAAGAATACATATCTCAAACACTTATAAATATATATATATATATATAT ATATATATTAATATTCATATATGAAAATATTAAGTACACATATTTTTTTTAAAAACAATACAAAATTTTTAATTTGCTTA TATTTTTGAACTACATAAACATACATATATTTACATGTATGTATCCGTTTTAAAAAAGTTTAAAGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504983: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049831675167N981172208C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:27:58 on Fri 24 Nov 117.