EST 504987 is a singleton


Sequence

>504987 (1 EST) Length=175 ATTTTTAAAAAAAGTGGATATGAATATAGAAAAAAAATAAATTAGAAAGATGTTTTAAATTTTTAAGATTCCTAATTAAA CATAAGGAGAAGCATTTATCCTTATCTGAACTTATAGACCCATTTAAAGCTGCCTGTAGAAAGATATATCCACTAGCAAC AGCTTTCGAATGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049871675171N981212213C3czapPFDd2.1, Debopam Chakrabarti


Date: 22:22:20 on Sat 18 Nov 117.