EST 504995 is a singleton


Sequence

>504995 (1 EST) Length=98 TATTTAAAAGTTGTTATAATAGCTTATAACGAAAAGTGTAATAACGTGTGCTGTATTTCCTCATTAACTTTTATTAAGAT ATATGATATTTAATAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504995: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049951675179N981292223C3czapPFDd2.1, Debopam Chakrabarti


Date: 11:50:49 on Thu 23 Nov 117.