EST 504999 is a singleton


Sequence

>504999 (1 EST) Length=229 GAATGTAACATCGAACCAGAAGCACAACAACATTTACACAAATAAGGATGATAACACAAATTATGATAACACAAATTATG ATAACATAAATTATGATAACATAAATTATGATAACATAAATTATGATAACACAAATTATGATAACACAAATTATGATAAC ATAAATTATGATAACATGAATGAATGTGATGATCATANTTCTTCAGATNGCCACATAAAAAAAAAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504999: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5049991675183N981332228C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:12:19 on Thu 23 Nov 117.