EST 506105 is a singleton


Sequence

>506105 (1 EST) Length=390 ACGAAAGCATTTGGGACTGCTGTGCATGATGGATGTTTATATGCGTAGGTGGCGAGATAATGCTTGTGACTATCACGGNA GAGAATATGACCGACACGAATGAATGGGTCATGTTGTTGCAATGACATCGGAGATCCGGGGTGGGTTTGGTGTAGTTAAT GACAGTNGTATGCAGCGGCGGNTTTGATGGTACACATCCTAAAGACGCAGAAGTTTATGATCGAGANACAAATCATGGNG CAGCGGGATGTATGATATCCGACGGCTTGGTGGCGGTGTCGCGTNGCCGATAGACACGACATNTGTGCANCAGCTGGATC CTGATTGAACNCCCGACNACCCCTTNGNTGTGATCCGCCTCTTCCACAGCTGNTGTCAGCGAAGATCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 506105: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5061051270732N99317SWAMCA531SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:20:9 on Tue 21 Nov 117.