EST 507236 is a singleton


Sequence

>507236 (1 EST) Length=110 TGAGGATCGGACGAGCGGCACGAGCGGCACGAGTTGATGCATTGTACGAATATTGCTGAAATGTGTAAATGAAATTATTG GAAGAGTTTTTCGTTATTTTCATCCTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 507236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5072361271720W00306RRAMCA1115SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:44:15 on Wed 22 Nov 117.