EST 507241 is a singleton


Sequence

>507241 (1 EST) Length=331 CTTTTTCATCTGATAGAATTTTAAGACTCATTTGACTTCTCATTTTATCGAATATACCTTCTCCTCTCATAAAAAGTTAA CCACTGGAAGAAATGGATGTGACAGATCCATATTTTTCTGTACGAGAAGTTTTAGACAAATTTCCCACCGACGACAGTGT CAAGGAATCAATGGAGCAACGTGATATCGATTACCATCAAATTCATGTCAATATATTGCATACTGTTGGAGAACTGAATT GTTTAAAGCCATCTTATAATGGACAAGTGAATACGAACCTCGCCGAGAAAGAAACTTTATTAACTACACTATATTCAATC GAAAGAGATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 507241: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5072411271725W00311RRAMCA1122SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 20:34:17 on Thu 23 Nov 117.