EST 507246 is a singleton


Sequence

>507246 (1 EST) Length=447 TCTGAGTAGTGACTGTAATGTGTCTTCATGGCAAGAGCTTTAGCTCGACGTGATAACAACGGTGCAACACTACCAAGACG ATGAAGACTCTGACGATAGTTGCACGGGCGATGGTGAGGAGAAGGACGAGGACGACGAGGAGAAAGATAATGATGAAGAA TTTTATGATTATGATCAAAATCATCGATCATATAATCATCGTCGTACACCATCATATCATGTTAAGTGCATGAAAGATTA TGAGGAAGATTACGACGACGAGTTAGTTTCATCAACATCAAAGCATAATCGTACACAAGTTAAAAAGAAAAAAAAATTAA GTAAAACACGTNAAGCGACCACTGCTACGCCAACAATTTCAAATAGAACAAAATCGCTCACAAATGGAAAAGCTAAGAAA ATTACTGCTCGATGTNTTCAAAAAANCAAACGCAGTCCATCNTGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 507246: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5072461271730W00316RRAMCA1129SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:57:16 on Sat 18 Nov 117.