EST 507699 is a singleton


Sequence

>507699 (1 EST) Length=328 GGTTTNTTGATGAATCGGTGCCACAGTGGATCGAAGTATTTCTCTTGGCTTTCAAGGATTTTTAGTCAGCTTAATTGCAA CACTACCATCATCAATTTGNTGGGGTTGGATTGTTGACAAAGCTTGCATCATGTGGAATAGCATTTGTGGACAACAATTT CGAGGTGCTTGTGAATTATATGACAGTAATAAATTACGTCTGATGACTCATTTAACTTATGGCTTAATGAGATTGGTATC ATCAANACCAGATATTGCTGTATGCTATTATGCAAAAAATCTTTTACTAATCGATCATGGATTAAATGAAGTCATCTAAA TTTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 507699: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5076991272183W00768SWAMCA570SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:27:24 on Thu 23 Nov 117.