EST 507706 is a singleton


Sequence

>507706 (1 EST) Length=431 GCAATCCGTGCTAGCAGACGGCTGTATATTATTTCAAAGAAATGCCACGAAAAGTTCCATCACAACTAGAATCAAAAGTA ATTGATACCAGCGATAATGGTGATGATTTAATGACGGGAATTTCAATTTCACAAGAGAAACTGACCAATCATCANCCCTC AAATGATAATATGGAAAATATTACTATGTACAAATCATCGTCATCATCATCATCATCATCAAATGATCATCACTCACAGT CATTCTTTNTCAACGATGATATTATCGGTCAGAAATACGTGGAAACAGCAAANCTNCCAGGAATGAAACATCTTCATGGN ACAAAAATTNTATGGAAAAAAACGCAAAATGTCCTCGANTTGCCANTTCTTGGACATTTTCAAACGTACGAGAAACGTGT CGAGCGATCATGTCCAAATCCATGGGGTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 507706: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5077061272190W00775SWAMCA579SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 9:25:19 on Sun 19 Nov 117.