EST 512332 is a singleton


Sequence

>512332 (1 EST) Length=204 AATTTTTTNTNTTGAAATNNGTACATTACAGTAATAGATGTTTAATTATAACTCTTTGTTATTTATGAATGCTTTTTTCT TTGGGAAACTTTCTTAGTTGAAATTGNAAATGTGGATGCAGTTTTCCTCTGTAAGTAACTTTTTGCTAGCATCATAGAAA AATAAGTAAAGAGTACCAGTCTNTTGTTATGAATGATAATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 512332: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5123321278115W05382RRAMCA117SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:21:32 on Sun 19 Nov 117.