EST 512343 is a singleton


Sequence

>512343 (1 EST) Length=275 CGAAAGACGAGAGAATTATTAATTNAAGATTATCTTATAACTCTTCAAGATTCTACAGTCTATTTCACCGTATCGTTTTA AAAGAAAGGAAATTAGAACTTAAAACAACGATGGATAATGAAGCATAAGGATCGTACGGATGATATTACCAATTGTCCAT CTATCGAGGACATATGATATCATACCTAATGAAATCCCACCGTCCTGACAAAACAGAAACCAGTAATGTCATAACTGATT TGTCAATCTCAAATGCTAATTACTGAATGGACAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 512343: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5123431278126W05375RRAMCA130SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 18:58:16 on Thu 23 Nov 117.