EST 513684 is a singleton


Sequence

>513684 (1 EST) Length=424 GCATTTAGGGTTTTCATCAGGCGGTTGTCATTAGTTGGGAATGAACGCCAACAAGGATGAAGCGCAGAAATGTGTATTTA TTGCTAGAAAACGTTTAGTCACGGGGGATCGTGATGGTGCAAAAAAGTTTCTCCTGAAAGCCATGAGATTGGATCCGTCA GTCAACATAGAAGGACTGGAGTTTTTAGTGAAACCTAGGTCTCGTTCGTCTAGCACCAGAGGTTCCCAAGAAAATGGAGG TCCCTATCCTAGCGCTGAATCTACCAGAAATAAACAACCGGATAAGGAATTCACTAAAACCCAAATAGNTTCGTTGAGGA AAGTACTGGCTTGCAAAAATTACTACGGAATTCTTGGGGTTTCGCAAACTGCATCAGACGAGGNATTAACCGGCTTTTAA ACTTCATGCCCTCAAGGTTCATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 513684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5136841444937W06716SMEST0353Schistosoma mansoni, adult worm, Gloria Franco


Date: 9:37:40 on Fri 24 Nov 117.