EST 513691 is a singleton


Sequence

>513691 (1 EST) Length=369 ATATGGCCAAACCATTTTTGGACTCGAAGTGAAATGCATTGTCAGCCTGCAAACTCCAAATCGATCAACGGCTGCNGCTT CGGGAGAAACTTCTATGGTTTGACACAGATCTGAAAGAAAAGANCATTAAGGNTGACGGCNAGGACAAAACACCTAAGTG GTTCCCACTTACATATCGGTAAGCTATGACACTAGGCACTTACACGNTTAGGCATGAAGGAAAACAAGCTGTAGGTCTCT ACGGATGTTAACTTTAGAGGCTGTCTGTAGTCACGACGACGATGTCGACGGCTCACAGATGCCGAGATGTAAGGCAGTTT ATGCCCGCCGCAATGAAGTCAAAGATGCCAATTTTCGAGTTAAGTACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 513691: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5136911444944W06724SMEST0360Schistosoma mansoni, adult worm, Gloria Franco


Date: 2:28:12 on Wed 22 Nov 117.