EST 513717 is a singleton


Sequence

>513717 (1 EST) Length=418 GCTCGGTACCCGGGGATCCTCTAGAGTCTGGCCAACATGGTGAGACCCCACCTATACTGAAAATTCAAAAATTAGCCGGG CATGGTGGTGGGCACCTGTAATAACAGCTACTCGGGATGCTGAGGCAGAAGAATCGCTCACAAGTGCTCACCACTGTTGC GGGAAGTCAGGGACCCCTAACAGACGGACCGGCTGGAGCCACGGCAGAGGAACATAAATTGTGAAGATAACATGGACATT TATCACTTCCCAAATAATACTCTTATAATTTCTTACGCCTGTCTTACTTTCATCTCTTAATCCTGTTATCTTCATAAACT GAGGATGTACGTCACCTCAGGACCCTGTGATAATTGTGTTAACTGTACAAATTGATTGTAAAATGTGTGTTTGAACAATG TGAAATCAGCGCACATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 513717: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137171444970W06750SMEST0386Schistosoma mansoni, adult worm, Gloria Franco


Date: 15:17:23 on Fri 24 Nov 117.