EST 513719 is a singleton


Sequence

>513719 (1 EST) Length=265 GAAAATTTAAAAGATATATGACTCACAATACTCGATTGATGAAACACTTAAGAACACTAAATTTTTGACACACAATCTTA GATGAACTCATATAATAAAAGAACTTAGAAAAGTTTAAAATGTACAATATTGTTATTATAAGTGGTATACGATAATGAAG ATCACAAAGTAAATGGTATCGACATATACAAAAGAATAAAGTACAACTTAACACTTAGTTGAATACAAAATTGAAAGAAA TACAATAGTATAGGATGTGTAGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 513719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137191444972W06752SMEST0388Schistosoma mansoni, adult worm, Gloria Franco


Date: 18:24:32 on Fri 17 Nov 117.