EST 513724 is a singleton


Sequence

>513724 (1 EST) Length=378 GATCGGCCCGATACGGGCCTCGTGTCGCTGATGCTCGTGAACAACGAAATCGGCACGCTGACCGATATCGGCGCGATCGC CCGCATCGTGCACGCGGCCGGCGCGCTGTTCCACGTCGACGCCGCGCAGGCGCTCGGCAAGACGCCGATCGACGTGCGCG CGCTCGGCATCGACCTGATGTCGATGTCGGCCCACAAGGTTTATGGTCCCAAGGGCATCGGCGCGCTGTTCGTCCGCCGC GAGATCGCCGATCGCATCGCCCCGCAGATTCACGGCGGCGGTCACGAGCGCGGGTTGCGCTCGGGCACGCTCGCGACGCA TCAGATCGTCGGGATGGGCGTCGCGTGCGAACTCGCCGCTGAAAAGCTCGACGGCGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 513724: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137241444977W06757SMEST0393Schistosoma mansoni, adult worm, Gloria Franco


Date: 20:40:45 on Tue 21 Nov 117.