EST 513747 is a singleton


Sequence

>513747 (1 EST) Length=332 AAGATAAGGGGTTATTACGACTGAAACAATGAAGGAAATTTAAAGAGAGAAATATACAATTTAGTCACAAATTTCGCGTT ATACTGTACATCAGAAAACATTGCTTGGACAAATTTTAGTCATTATCCACGGCACCATCAGCTTTAGCATATCGTATTCT TGTACAGGCTATTTGCTGTAATGTACAAACAGCATCTTCAACATCAGTTGATTCGTCATCATCCGAATCTGTTGACTGGT CAGAATCTGAAGTTGAATATTCGCTTAATCCAGGCAGCACAGCGACAGGTCGCATGACAGAACCATTAAGCAATTTAGAG ACAACTGGGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 513747: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137471445000W06780SMEST0416Schistosoma mansoni, adult worm, Gloria Franco


Date: 2:54:6 on Mon 20 Nov 117.