EST 513749 is a singleton


Sequence

>513749 (1 EST) Length=356 GAATCGAGTTAGATTTTATTTAATAATAAAAAGCAGCACACCAAGAGAATTTGTTTAAAAGTATGATGAAATTAAGTCCT TCATTTCAATGACGTTCCATTCATTGAATCTTCAATACGCATCTTTGAATGGATACTCGGAATGATTAGCCATTTTCAAC AATTTGAATTGACGTTCATTCAAACCTTTTGTATTCAATTCATGCATTTCCTCTTTTGAAAGTTGGAAATCAAATACCCC AAAGTTTTCTTCAATTCGTTTCGGTGTTACAGACTTTGGAACTATTATCAAGTTTCTTTGAATTAAATAACGCAAGAGAA CTTGAGCCGGTGTTTTACCGTGATGTTTAGCAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 513749: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137491445002W06782SMEST0418Schistosoma mansoni, adult worm, Gloria Franco


Date: 17:19:1 on Wed 22 Nov 117.