EST 513752 is a singleton


Sequence

>513752 (1 EST) Length=154 CTTTTCCTGAAAACAAACAACTTTTTTATATTAGAAAATATTGAGAAAAAGAAAAGAATTTAAAGATATGATAATTAGCA CAACACAATATTTTTTTTTTGGGGGGGGGGTTCATTTAGAAAAAAGGAAACGATCTAACCTAAAATATCAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 513752: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137521445005W06785SMEST0421Schistosoma mansoni, adult worm, Gloria Franco


Date: 23:21:52 on Mon 20 Nov 117.