EST 513758 is a singleton


Sequence

>513758 (1 EST) Length=288 AGTGCAAATAATTTATTGCAATCTGGTAGATAATCTATCAATCATACCGTACAGGCAACCAGTGAAAAAAGTTAATACTC ATAAAANTTTTGTACAGAGTAAAATTAAATCATTCATATGTACAATTTACCTTCGGTGATGATCGTGATGTCGACTCGAA ACTAGACGATGGTTAGAGTGCTCACGCAATATACGACCACTTTCACCATTTGGTGCAGATCGCAATGATGAACGATGTTT GCTTTTATGTGACTTATTATAATCCATTCGGTAGGCATAGGGCGGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 513758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137581445011W06791SMEST0427Schistosoma mansoni, adult worm, Gloria Franco


Date: 13:40:21 on Thu 23 Nov 117.