EST 513766 is a singleton


Sequence

>513766 (1 EST) Length=253 ATCAACCTTGAAAATAGAATCTTTCTTCGAGAAAAAACACAAAATAAACTATTTAGTTATATCATATCATTCATTTCATT AACAATGAGAAAGTGTTCGTCCCCACCTCCCTTACAAAAAAAGATGTGACGTAAGCAGGAAAGAAGAGAAAAACAAACAA ATAAATAAAAAGTGATTTTCCCACTGCTTTGTTGATATTCTTCACTTCTCTTAACTCAGAAGTGAAAATGTGGATAAGTT TTTTTTCCCAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 513766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137661445019W06799SMEST0435Schistosoma mansoni, adult worm, Gloria Franco


Date: 19:32:32 on Sun 19 Nov 117.