EST 513778 is a singleton


Sequence

>513778 (1 EST) Length=242 ATACCAATTAACCAATTCAATTTTTAATCTGAATACAAATTAAGGCAACATATGTGTATGTGTGTGTGTACACAAATCTA TACTGTATGTATGTGTGTTTTGTGTCTGTTTTGCTTTTGCCTACAGAAAAGCAAGAATCAGTATATATATATGACACCAT AGACAGTTAGACGCTTATTGACTTGAATTGCTTCATCCCCATTTCATACCATTTATTTCCTTCCTTCCTGTCTGGTTCTT TC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 513778: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137781445031W06811SMEST0447Schistosoma mansoni, adult worm, Gloria Franco


Date: 11:59:23 on Thu 23 Nov 117.